avidin-fitc (Vector Laboratories)
Vector Laboratories is a verified supplier 
Vector Laboratories manufactures this product 
95
Structured Review
Vector Laboratories
avidin-fitc
Avidin Fitc, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 95/100, based on 414 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fitc+avidin+dcs/Fluorescein+Avidin+DCS%2C+Cell+Sorting+Grade/pmc11152312-246-32-33
Average 95 stars, based on 414 article reviews
Avidin Fitc, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 95/100, based on 414 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fitc+avidin+dcs/Fluorescein+Avidin+DCS%2C+Cell+Sorting+Grade/pmc11152312-246-32-33
Average 95 stars, based on 414 article reviews
avidin-fitc - by Bioz Stars,
2026-10
95/100 stars
Images
Related Articles
Blocking Assay:Article Title: Fusogenic micropeptide Myomixer is essential for satellite cell fusion and muscle regeneration Article Snippet: .. Mouse-on-mouse (BMK2202, Vector) blocking and detection reagents were used in conjunction with Article Title: Fusogenic micropeptide Myomixer is essential for satellite cell fusion and muscle regeneration. Article Snippet: .. Mouse-on-mouse (BMK2202, Vector) blocking and detection reagents were used in conjunction with Article Title: NEUROPROTECTIVE PROPERTIES OF MARROW-ISOLATED ADULT MULTILINEAGE INDUCIBLE CELLS IN RAT HIPPOCAMPUS FOLLOWING GLOBAL CEREBRAL ISCHEMIA ARE ENHANCED WHEN COMPLEXED TO BIOMIMETIC MICROCARRIERS Article Snippet: Immunofluorescence of MIAMI cells was done using mouse monoclonal anti-human-mitochondria antibodies (1:100) (Millipore) for 30 min at room temperature. .. Antibody binding was detected with biotinylated anti-mouse IgG (1/200) for 20 min at room temperature, followed by Avidin-Biotin Assay:Article Title: Genome-wide search of the genes tagged with the consensus of 33.6 repeat loci in buffalo Bubalus bubalis employing minisatellite-associated sequence amplification. Article Snippet: Abstract Minisatellites have been implicated with chromatin organization and gene regulation, but mRNA transcripts tagged with these elements have not been systematically characterized.. The aim of the present study was to gain an insight into the transcribing genes associated with consensus of 33.6 repeat loci across the tissues in water buffalo, Bubalus bubalis.. Using cDNA from spermatozoa and eight different somatic tissues and an oligo primer based on two units of consensus of 33.6 repeat loci (5′ CCTCCAGCCCTCCTCCAGCCCT 3′), we conducted minisatellite-associated sequence amplification (MASA) and identified 29 mRNA transcripts. Article Title: Chromosomal assignment of porcine pregnancy-associated glycoprotein gene family. Article Snippet: This study presents the chromosomal assignment of a multiple pregnancy-associated glycoprotein (PAG) gene family in the domestic pig (pPAG).. The pPAG locus was identified by physical mapping (fluorescent in situ hybridisation—FISH; with various probes), and additionally confirmed by Southern hybridisation of pPAG amplicons using laser microdissected Sus scrofa chromosome 1 (SSC1), as genomic templates.. Various pPAG probes were produced with the use of diverse identified templates: pPAG1-6, -8, -10 cDNAs (GenBank: L34360–1, AF315377, AF272734, AY188554, AF272735, AY373029 and AY775784, respectively), or genomic DNA (gDNA) probes of pPAG2 gene and its promoter (GenBank: U39198–9, U39762–3, U41421–4). Article Title: NEUROPROTECTIVE PROPERTIES OF MARROW-ISOLATED ADULT MULTILINEAGE INDUCIBLE CELLS IN RAT HIPPOCAMPUS FOLLOWING GLOBAL CEREBRAL ISCHEMIA ARE ENHANCED WHEN COMPLEXED TO BIOMIMETIC MICROCARRIERS Article Snippet: Immunofluorescence of MIAMI cells was done using mouse monoclonal anti-human-mitochondria antibodies (1:100) (Millipore) for 30 min at room temperature. .. Antibody binding was detected with biotinylated anti-mouse IgG (1/200) for 20 min at room temperature, followed by Fluorescence In Situ Hybridization:Article Title: Chromosomal assignment of porcine pregnancy-associated glycoprotein gene family. Article Snippet: This study presents the chromosomal assignment of a multiple pregnancy-associated glycoprotein (PAG) gene family in the domestic pig (pPAG).. The pPAG locus was identified by physical mapping (fluorescent in situ hybridisation—FISH; with various probes), and additionally confirmed by Southern hybridisation of pPAG amplicons using laser microdissected Sus scrofa chromosome 1 (SSC1), as genomic templates.. Various pPAG probes were produced with the use of diverse identified templates: pPAG1-6, -8, -10 cDNAs (GenBank: L34360–1, AF315377, AF272734, AY188554, AF272735, AY373029 and AY775784, respectively), or genomic DNA (gDNA) probes of pPAG2 gene and its promoter (GenBank: U39198–9, U39762–3, U41421–4). Binding Assay:Article Title: NEUROPROTECTIVE PROPERTIES OF MARROW-ISOLATED ADULT MULTILINEAGE INDUCIBLE CELLS IN RAT HIPPOCAMPUS FOLLOWING GLOBAL CEREBRAL ISCHEMIA ARE ENHANCED WHEN COMPLEXED TO BIOMIMETIC MICROCARRIERS Article Snippet: Immunofluorescence of MIAMI cells was done using mouse monoclonal anti-human-mitochondria antibodies (1:100) (Millipore) for 30 min at room temperature. .. Antibody binding was detected with biotinylated anti-mouse IgG (1/200) for 20 min at room temperature, followed by Immunostaining:Article Title: NEUROPROTECTIVE PROPERTIES OF MARROW-ISOLATED ADULT MULTILINEAGE INDUCIBLE CELLS IN RAT HIPPOCAMPUS FOLLOWING GLOBAL CEREBRAL ISCHEMIA ARE ENHANCED WHEN COMPLEXED TO BIOMIMETIC MICROCARRIERS Article Snippet: Immunofluorescence of MIAMI cells was done using mouse monoclonal anti-human-mitochondria antibodies (1:100) (Millipore) for 30 min at room temperature. .. Antibody binding was detected with biotinylated anti-mouse IgG (1/200) for 20 min at room temperature, followed by Fluorescence:Article Title: NEUROPROTECTIVE PROPERTIES OF MARROW-ISOLATED ADULT MULTILINEAGE INDUCIBLE CELLS IN RAT HIPPOCAMPUS FOLLOWING GLOBAL CEREBRAL ISCHEMIA ARE ENHANCED WHEN COMPLEXED TO BIOMIMETIC MICROCARRIERS Article Snippet: Immunofluorescence of MIAMI cells was done using mouse monoclonal anti-human-mitochondria antibodies (1:100) (Millipore) for 30 min at room temperature. .. Antibody binding was detected with biotinylated anti-mouse IgG (1/200) for 20 min at room temperature, followed by Microscopy:Article Title: NEUROPROTECTIVE PROPERTIES OF MARROW-ISOLATED ADULT MULTILINEAGE INDUCIBLE CELLS IN RAT HIPPOCAMPUS FOLLOWING GLOBAL CEREBRAL ISCHEMIA ARE ENHANCED WHEN COMPLEXED TO BIOMIMETIC MICROCARRIERS Article Snippet: Immunofluorescence of MIAMI cells was done using mouse monoclonal anti-human-mitochondria antibodies (1:100) (Millipore) for 30 min at room temperature. .. Antibody binding was detected with biotinylated anti-mouse IgG (1/200) for 20 min at room temperature, followed by |